Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17300211

Xenopus ORFeome
What is the ORFeome?

ORF Name:tbx3.S ORF1 Species: laevis
Gene Symbol: tbx3.S Entrez Gene ID: 397816
Gene Synonyms: tbx3-a, tbx3-b, xltbx3, xtbx3
Gene Name: T-box 3
Description: T-box transcription factor
Plate: GDExl11030 Well: D02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825924
3' ORF Sequence: JZ825923
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis transcription factor Tbx3, mRNA (cDNA clone MGC:79891 IMAGE:3400653), complete cds
Template Accession: BC077254
GI: 50414680
Clone ID: IMAGE:3400653
Tissue: whole organism
Stage: NF stage 24 to NF stage 25
Clone Library: NICHD_XGC_Emb3
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAATTTACCCATGAGAGACC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCAGGGGAACCGCTCCTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.9.2
Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556