Please note upcoming maintenance times for Xenbase - times are EST:

Wednesday 12-Dec-2018 before noon: BLAST, FTP (Xenbase will be partially functional)
Thursday 13-Dec-2018 before noon: Wiki, GBrowse, JBrowse (Xenbase will be partially functional)
Friday 14-Dec-2018 starting at 5 pm through weekend: Xenbase site and database (Xenbase will be completely down)

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17300229

Xenopus ORFeome
What is the ORFeome?

ORF Name:tc2n.S ORF1 Species: laevis
Gene Symbol: tc2n.S Entrez Gene ID: 496221
Gene Synonyms:
Gene Name: tandem C2 domains, nuclear
Description: Ca2+-dependent phospholipid-binding protein Synaptotagmin, required for synaptic vesicle and secretory granule exocytosis
Plate: GDExl11061 Well: F06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ833181
3' ORF Sequence: JZ833182
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC496221, mRNA (cDNA clone MGC:99147 IMAGE:7206061), complete cds
Template Accession: BC088683
GI: 56788930
Clone ID: IMAGE:7206061
Tissue: testis
Stage:
Clone Library: NICHD_XGC_Te2N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCCACAGAGTTTATAAAGAAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGAGGGATTCAAGCTATGCCAC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.10.0


Major funding for Xenbase is provided by grant P41 HD064556