Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17300271

Xenopus ORFeome
What is the ORFeome?

ORF Name:hnf1b.S ORF1 Species: laevis
Gene Symbol: hnf1b.S Entrez Gene ID: 380377
Gene Synonyms: hnf-1beta, hnf1-beta, hnf1beta, lfb3, tcf2, vhnf1
Gene Name: HNF1 homeobox B
Description: homeodomain transcription factor
Plate: GDExl11020 Well: F01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824649
3' ORF Sequence: JZ830000
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis transcription factor 2, mRNA (cDNA clone MGC:68954 IMAGE:4959359), complete cds
Template Accession: BC056024
GI: 33416787
Clone ID: IMAGE:4959359
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGTCCAAGCTATCGCCTTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACCATGCTTGCAAAGGACAC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers