Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17300277

Xenopus ORFeome
What is the ORFeome?

ORF Name:tcf21.L ORF1 Species: laevis
Gene Symbol: tcf21.L Entrez Gene ID: 444386
Gene Synonyms: capsulin, epicardin, pod 1, pod1
Gene Name: transcription factor 21
Description: helix-loop-helix transcription factor
Plate: GDExl11039 Well: E03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ827498
3' ORF Sequence: JZ827499
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis transcription factor 21, mRNA (cDNA clone MGC:82899 IMAGE:5512805), complete cds
Template Accession: BC073597
GI: 49256164
Clone ID: IMAGE:5512805
Tissue: spleen
Stage:
Clone Library: NICHD_XGC_Sp1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCACCGGTTCTCTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGATGCCGTGGGACCACACAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556