Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17300313

Xenopus ORFeome

ORF Name:tchp ORF1 Species: laevis
Gene Symbol: tchp.L Entrez Gene ID: 398528
Gene Synonyms:
Gene Name: trichoplein, keratin filament binding
Description: C-type lectin
Plate: GDExl11087 Well: C12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ838118
3' ORF Sequence: JZ838117
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein LOC398528, mRNA (cDNA clone MGC:154297 IMAGE:8070665), complete cds
Template Accession: BC124854
GI: 117167900
Clone ID: MGC:154297 IMAGE:8070665
Tissue: fat body
Stage:
Clone Library: NICHD_XGC_FaB
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTTACCTACACTCCCATCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGACCAAGCAGTTCTGGGGCGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556