Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17300511

Xenopus ORFeome
What is the ORFeome?

ORF Name:tf.S ORF1 Species: laevis
Gene Symbol: tf.S Entrez Gene ID: 379502
Gene Synonyms: lactotransferrin, serotransferin precursor, tf-a, tf-b, transferrin
Gene Name: transferrin
Description: iron homeostasis
Plate: GDExl11001 Well: G08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ839236
3' ORF Sequence: JZ839235
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis transferrin, mRNA (cDNA clone MGC:64251 IMAGE:6871784), complete cds
Template Accession: BC054950
GI: 32766601
Clone ID: IMAGE:6871784
Tissue: whole organism
Stage: NF stage 62
Clone Library: NICHD_XGC_Tad2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGATCTTTCTCTCCGTGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGGCACTGGGGGAACACT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.12.0


Major funding for Xenbase is provided by grant P41 HD064556