Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17300517

Xenopus ORFeome
What is the ORFeome?

ORF Name:tfap2a.S ORF1 Species: laevis
Gene Symbol: tfap2a.S Entrez Gene ID: 503683
Gene Synonyms: ap-2, ap2, ap2a, ap2alpha, tfap2a-a, tfap2a-b, tfap2alpha, xap-2, xap2
Gene Name: tto transcription factor AP-2 alpha
Description: transcription factor
Plate: GDExl11030 Well: H10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ826129
3' ORF Sequence: JZ826128
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: medium
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Tcfap2a protein, mRNA (cDNA clone MGC:82355 IMAGE:4202568), complete cds
Template Accession: BC082867
GI: 52430473
Clone ID: IMAGE:4202568
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCTCTGGAAACTAACGGATAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTCGGTGTTTTTCATCTTTATC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556