Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17300523

Xenopus ORFeome
What is the ORFeome?

ORF Name:tfap2a.S ORF2 Species: laevis
Gene Symbol: tfap2a.S Entrez Gene ID: 503683
Gene Synonyms: ap-2, ap2, ap2a, ap2alpha, tfap2a-a, tfap2a-b, tfap2alpha, xap-2, xap2
Gene Name: tto transcription factor AP-2 alpha
Description: transcription factor
Plate: GDExl11046 Well: A09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ830958
3' ORF Sequence: JZ830959
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis transcription factor AP-2 alpha, mRNA (cDNA clone MGC:81510 IMAGE:6637190), complete cds
Template Accession: BC068850
GI: 46250142
Clone ID: IMAGE:6637190
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTTGGTTCACAGTTTTTCCGCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTTTCGGTGTTTTTCATCTTTATC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556