Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17300577

Xenopus ORFeome
What is the ORFeome?

ORF Name:tfdp1.L ORF1 Species: laevis
Gene Symbol: tfdp1.L Entrez Gene ID: 494744
Gene Synonyms: dp-1, dp1, drtf1, tfdp1-a, tfdp1-b
Gene Name: transcription factor Dp-1
Description: E2F-like protein
Plate: GDExl11043 Well: B06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ828103
3' ORF Sequence: No sequence available
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC494744, mRNA (cDNA clone MGC:80978 IMAGE:5536732), complete cds
Template Accession: BC082841
GI: 52354614
Clone ID: IMAGE:5536732
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAAAAGATGCTGGTCTTA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCATCATCAAGATCATCATCATC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556