Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17300637

Xenopus ORFeome
What is the ORFeome?

ORF Name:tgfb1.L ORF1 Species: laevis
Gene Symbol: tgfb1.L Entrez Gene ID: 397778
Gene Synonyms: ced, dpd1, lap, tgf beta, tgf-beta, tgf-beta 5, tgf-beta5, tgfb, tgfb5, tgfbeta, transforming gorwth factor-beta5, transforming growth factor-b5
Gene Name: transforming growth factor beta 1
Description: growth factor
Plate: GDExl11092 Well: C07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ838962
3' ORF Sequence: JZ838961
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis transforming growth factor-beta 5, mRNA (cDNA clone MGC:160408 IMAGE:8548338), complete cds
Template Accession: BC129720
GI: 120538306
Clone ID: IMAGE:8548338
Tissue: thymus
Stage:
Clone Library: NICHD_XGC_thy
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGGTTCTGTGGATG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCTGCAGTTGCAAGACC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556