Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17300691

Xenopus ORFeome
What is the ORFeome?

ORF Name:thap1.L ORF1 Species: laevis
Gene Symbol: thap1.L Entrez Gene ID: 495360
Gene Synonyms:
Gene Name: THAP domain containing, apoptosis associated protein 1
Description:
Plate: GDExl11006 Well: G01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ840008
3' ORF Sequence: JZ840007
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: no
Original XGC clone QC Flag: yes



Template Information
Description: Xenopus laevis hypothetical LOC495360, mRNA (cDNA clone MGC:85315 IMAGE:6875586), complete cds
Template Accession: BC084824
GI: 54311495
Clone ID: IMAGE:6875586
Tissue: whole organism
Stage:
Clone Library: NICHD_XGC_Tad2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGCAATCGTGCTCAGCTT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGAATAATTTCCTTATATGTTAT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556