Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17300955

Xenopus ORFeome
What is the ORFeome?

ORF Name:tle4.S ORF1 Species: laevis
Gene Symbol: tle4.S Entrez Gene ID: 399397
Gene Synonyms: esg4, grg-4, grg4, gro, groucho-related gene 4, x-groucho, xgrg-4, xgrg4, xtcf-4, xtle4
Gene Name: transducin like enhancer of split 4
Description: transcriptional regulator
Plate: GDExl11051 Well: A05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ831626
3' ORF Sequence: JZ831627
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis groucho protein, mRNA (cDNA clone MGC:86378 IMAGE:7011138), complete cds
Template Accession: BC079799
GI: 50925318
Clone ID: IMAGE:7011138
Tissue: mesonephric kidney
Stage:
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATTCGAGACTTGAGCAAGAT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATAAATAACTTCATAGACTGTGGC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers