Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17301837

Xenopus ORFeome
What is the ORFeome?

ORF Name:tnik.S ORF1 Species: laevis
Gene Symbol: tnik.S Entrez Gene ID: 443633
Gene Synonyms:
Gene Name: TRAF2 and NCK interacting kinase
Description: germinal center kinase
Plate: GDExl11066 Well: E09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ834251
3' ORF Sequence: JZ834252
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein LOC443633, mRNA (cDNA clone MGC:130721 IMAGE:7976337), complete cds
Template Accession: BC108456
GI: 80476238
Clone ID: IMAGE:7976337
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb9
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGAGCGACTCCCC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCTGTTGCCGTTGCTGCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers