Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17302053

Xenopus ORFeome
What is the ORFeome?

ORF Name:tp53.L ORF1 Species: laevis
Gene Symbol: tp53.L Entrez Gene ID: 397926
Gene Synonyms: p53, trp248, tumor suppressor p53, xp53, xrel3
Gene Name: tumor protein p53
Description: transcription factor regulating cell cycle, apoptosis and TGF-beta signaling
Plate: GDExl11068 Well: B12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ834686
3' ORF Sequence: JZ834687
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis tumor suppressor protein p53, mRNA (cDNA clone MGC:79985 IMAGE:6864775), complete cds
Template Accession: BC084064
GI: 54035091
Clone ID: IMAGE:6864775
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAACCTTCCTCTGAGAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCCGAGTCGGGCTGTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556