Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17302761

Xenopus ORFeome
What is the ORFeome?

ORF Name:ttc25.L ORF1 Species: laevis
Gene Symbol: ttc25.L Entrez Gene ID: 414568
Gene Synonyms:
Gene Name: tetratricopeptide repeat domain 25
Description: TPrepeat
Plate: GDExl11063 Well: E06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ833730
3' ORF Sequence: JZ833731
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein LOC414568, mRNA (cDNA clone MGC:130758 IMAGE:7205850), complete cds
Template Accession: BC108468
GI: 80477534
Clone ID: IMAGE:7205850
Tissue: testis
Stage:
Clone Library: NICHD_XGC_Te2N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGAGGAGACGGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCCTTCATCCTCTTCTGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556