Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17303187

Xenopus ORFeome

ORF Name:uba3 ORF1 Species: laevis
Gene Symbol: uba3.S Entrez Gene ID: 734782
Gene Synonyms: ube1c
Gene Name: ubiquitin like modifier activating enzyme 3
Description: ubiquitin-protein ligase
Plate: GDExl11067 Well: E09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ834479
3' ORF Sequence: JZ834480
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC131020, mRNA (cDNA clone MGC:131020 IMAGE:7979817), complete cds
Template Accession: BC106399
GI: 77748136
Clone ID: MGC:131020 IMAGE:7979817
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGATGCTGAAGAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCTGTAAAATGCAGTTTGAAC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556