Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17303463

Xenopus ORFeome

ORF Name:ubl5 ORF1 Species: laevis
Gene Symbol: ubl5.S Entrez Gene ID: 594873
Gene Synonyms:
Gene Name: ubiquitin like 5
Description: Ubiquitin-like protein
Plate: GDExl11078 Well: D09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ836560
3' ORF Sequence: JZ836561
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Ubl5 protein, mRNA (cDNA clone MGC:84907 IMAGE:3748978), complete cds
Template Accession: BC089084
GI: 57870139
Clone ID: MGC:84907 IMAGE:3748978
Tissue: whole organism
Stage: NF stage 10.5 to NF stage 11.5
Clone Library: Xenopus laevis gastrula non normalized
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGATCGAGGTTGTATGCAACGAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTGGTAATATAACTCCAGGTTC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556