Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17303487

Xenopus ORFeome
What is the ORFeome?

ORF Name:ubqln4.L ORF1 Species: laevis
Gene Symbol: ubqln4.L Entrez Gene ID: 380499
Gene Synonyms: a1u, c1orf6, cip75, ubin
Gene Name: ubiquilin 4
Description: Ubiquitin-like protein
Plate: GDExl11013 Well: F06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824047
3' ORF Sequence: JZ829357
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis chromosome 1 open reading frame 6, mRNA (cDNA clone MGC:53873 IMAGE:5543023), complete cds
Template Accession: BC047982
GI: 29126825
Clone ID: IMAGE:5543023
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCGGAGAGCGGCGCT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGAGGGCTGGGAGCCCAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556