On Friday November 24, 2017 around 5 pm EST portions of Xenbase may be intermittently available.

Click on this message to dismiss it.
Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17303499

Xenopus ORFeome

ORF Name:ubtd2 ORF1 Species: laevis
Gene Symbol: ubtd2.S Entrez Gene ID: 447780
Gene Synonyms:
Gene Name: ubiquitin domain containing 2
Description: Uncharacterized conserved protein
Plate: GDExl11059 Well: D08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ833071
3' ORF Sequence: JZ833072
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC84411 protein, mRNA (cDNA clone MGC:84411 IMAGE:7019151), complete cds
Template Accession: BC082473
GI: 51950054
Clone ID: MGC:84411 IMAGE:7019151
Tissue: brain
Stage: frog
Clone Library: NICHD_XGC_Brn1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAGGGTGTGTGGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTCTCTACCGGTGTGGGATT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556