Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17303931

Xenopus ORFeome
What is the ORFeome?

ORF Name:usp12b.S ORF1 Species: laevis
Gene Symbol: usp12b.S Entrez Gene ID: 379981
Gene Synonyms: usp46
Gene Name: ubiquitin specific peptidase 12b
Description: protease
Plate: GDExl11017 Well: F05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824376
3' ORF Sequence: JZ829735
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: low
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis ubiquitin specific protease 46, mRNA (cDNA clone MGC:53480 IMAGE:5572291), complete cds
Template Accession: BC044045
GI: 27696465
Clone ID: IMAGE:5572291
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCAACAGGATGCCCATGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCTCTAGATTGATAGAACAGG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556