Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17304057

Xenopus ORFeome

ORF Name:vangl1 ORF1 Species: laevis
Gene Symbol: vangl1.L Entrez Gene ID: 734910
Gene Synonyms: stb2, van gogh
Gene Name: VANGL planar cell polarity protein 1
Description: Signaling protein van gogh/strabismus
Plate: GDExl11066 Well: C07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ834320
3' ORF Sequence: JZ834321
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC130980, mRNA (cDNA clone MGC:130980 IMAGE:7976921), complete cds
Template Accession: BC108531
GI: 80476366
Clone ID: MGC:130980 IMAGE:7976921
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb9
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACACGGAATCCAACCACT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACAGGTTGGTCTCAGGTTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556