Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17304063

Xenopus ORFeome

ORF Name:vangl2 ORF1 Species: laevis
Gene Symbol: vangl2.L Entrez Gene ID: 398271
Gene Synonyms: lpp1, ltap, stb1, stbm, stbm1, strabismus, van gogh, vang-like 2, vangl2-a, vangl2-b
Gene Name: VANGL planar cell polarity protein 2
Description: Non-canonical wnt pathway signaling protein
Plate: GDExl11035 Well: A08
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ826838
3' ORF Sequence: JZ826839
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis strabismus, mRNA (cDNA clone MGC:79843 IMAGE:5073854), complete cds
Template Accession: BC072119
GI: 48734631
Clone ID: MGC:79843 IMAGE:5073854
Tissue: ovary
Stage: frog
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGACAACGATTCCCAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAACCGAGGTCTCCGATTG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556