Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17304201

Xenopus ORFeome
What is the ORFeome?

ORF Name:vim.S ORF2 Species: laevis
Gene Symbol: vim.S Entrez Gene ID: 386600
Gene Synonyms: vim-a, vim-b, vimentin
Gene Name: vimentin
Description: intermediate filament
Plate: GDExl11013 Well: E12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824181
3' ORF Sequence: JZ829486
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis vimentin 4, mRNA (cDNA clone MGC:53233 IMAGE:5543495), complete cds
Template Accession: BC045233
GI: 28277304
Clone ID: IMAGE:5543495
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAACAACCAAATCATCTTAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCCAGGTCCAGGTCCA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556