Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17304207

Xenopus ORFeome
What is the ORFeome?

ORF Name:vim.L ORF1 Species: laevis
Gene Symbol: vim.L Entrez Gene ID: 386601
Gene Synonyms: vim-a, vim-b, vimentin
Gene Name: vimentin
Description: intermediate filament
Plate: GDExl11028 Well: F12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825692
3' ORF Sequence: JZ825693
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis vimentin 1, mRNA (cDNA clone MGC:53668 IMAGE:4888155), complete cds
Template Accession: BC045052
GI: 28278762
Clone ID: IMAGE:4888155
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb2
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAACAACCAAGTCATC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCAAAGTCATCGTGGTG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.15.0
Major funding for Xenbase is provided by grant P41 HD064556