Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17304213

Xenopus ORFeome
What is the ORFeome?

ORF Name:vim.L ORF2 Species: laevis
Gene Symbol: vim.L Entrez Gene ID: 386601
Gene Synonyms: vim-a, vim-b, vimentin
Gene Name: vimentin
Description: intermediate filament
Plate: GDExl11049 Well: H07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ831462
3' ORF Sequence: JZ831463
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis vimentin 1, mRNA (cDNA clone MGC:83389 IMAGE:7008042), complete cds
Template Accession: BC080051
GI: 51258383
Clone ID: IMAGE:7008042
Tissue: mesonephric kidney
Stage:
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAACAACCAAGTCATC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCAAAGTCATCGTGGTG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556