Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17304249

Xenopus ORFeome
What is the ORFeome?

ORF Name:vldlr.S ORF1 Species: laevis
Gene Symbol: vldlr.S Entrez Gene ID: 399346
Gene Synonyms: vitellogenin receptor
Gene Name: very low density lipoprotein receptor
Description: EGF-like calcium ion binding
Plate: GDExl11027 Well: G02
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ825453
3' ORF Sequence: JZ825452
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis vitellogenin receptor, mRNA (cDNA clone MGC:79933 IMAGE:6634351), complete cds
Template Accession: BC070552
GI: 47123898
Clone ID: IMAGE:6634351
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCCGCTCCTGGAGGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGACAAGTCGTCATCTGTGTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers