Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17304507

Xenopus ORFeome

ORF Name:was ORF1 Species: laevis
Gene Symbol: was.L Entrez Gene ID: 100037214
Gene Synonyms: imd2, thc, thc1, wasp
Gene Name: Wiskott-Aldrich syndrome
Description: actin regulatory protein
Plate: GDExl11092 Well: B09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ838946
3' ORF Sequence: JZ838945
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein LOC100037214, mRNA (cDNA clone MGC:160429 IMAGE:8550483), complete cds
Template Accession: BC129739
GI: 125858159
Clone ID: MGC:160429 IMAGE:8550483
Tissue: thymus
Stage:
Clone Library: NICHD_XGC_thy
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGTCGAGGGGGGCCTAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTCCTCCCATTCATCATC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556