Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17304513

Xenopus ORFeome

ORF Name:wasf1 ORF1 Species: laevis
Gene Symbol: wasf1.S Entrez Gene ID: 444717
Gene Synonyms: scar1, wave1
Gene Name: WAS protein family member 1
Description: Wiskott Aldrich syndrome proteins
Plate: GDExl11057 Well: E04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ832619
3' ORF Sequence: JZ832620
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC84671 protein, mRNA (cDNA clone MGC:84671 IMAGE:6945208), complete cds
Template Accession: BC074429
GI: 49257877
Clone ID: MGC:84671 IMAGE:6945208
Tissue: eye
Stage: frog
Clone Library: NICHD_XGC_Eye1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCTCTGGTTAAAAGAAACATC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTCTAGCCATTCTACCTCATCA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556