Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17304519

Xenopus ORFeome

ORF Name:wash1 ORF1 Species: laevis
Gene Symbol: washc1.L Entrez Gene ID: 495507
Gene Synonyms: wash1
Gene Name: WASH complex subunit 1
Description: Growth factor receptor-bound proteins (GRB7, GRB10, GRB14)
Plate: GDExl11071 Well: E01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ835099
3' ORF Sequence: JZ835100
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical LOC495507, mRNA (cDNA clone MGC:98885 IMAGE:4057407), complete cds
Template Accession: BC085201
GI: 55153762
Clone ID: MGC:98885 IMAGE:4057407
Tissue: lung
Stage: frog
Clone Library: NICHD_XGC_Lu1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCCACAGAATCGGTCAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGACTCCCAGTCATCCTCA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556