Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17304537

Xenopus ORFeome

ORF Name:wbp2 ORF2 Species: laevis
Gene Symbol: wbp2nl.S Entrez Gene ID: 100036783
Gene Synonyms: pawp
Gene Name: WBP2 N-terminal like
Description: WW domain binding protein WBP-2, contains GRAM domain
Plate: GDExl11084 Well: C01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ837374
3' ORF Sequence: JZ837373
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis WW domain binding protein 2, mRNA (cDNA clone MGC:154838 IMAGE:8329572), complete cds
Template Accession: BC124980
GI: 117167942
Clone ID: MGC:154838 IMAGE:8329572
Tissue: ovary
Stage: frog
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCACTTAATAAGAACCACTCA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTGTTCTTCTTATCCTCATAGGG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556