Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17304555

Xenopus ORFeome

ORF Name:wbscr16 ORF1 Species: laevis
Gene Symbol: rcc1l.L Entrez Gene ID: 735132
Gene Synonyms: wbscr16, williams-beuren syndrome chromosome region 16
Gene Name: RCC1 like
Description: RCC1 domain
Plate: GDExl11082 Well: H01
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ837137
3' ORF Sequence: JZ837136
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC115671, mRNA (cDNA clone MGC:115671 IMAGE:6324171), complete cds
Template Accession: BC097888
GI: 66911610
Clone ID: MGC:115671 IMAGE:6324171
Tissue: egg
Stage: unfertilized egg stage
Clone Library: Wellcome CRC pSK egg
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGGACTTCATTGTTCTTCAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACATTAATGATTTCACAAGAGCCAC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556