Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17304669

Xenopus ORFeome
What is the ORFeome?

ORF Name:wdr5.S ORF1 Species: laevis
Gene Symbol: wdr5.S Entrez Gene ID: 447447
Gene Synonyms: big-3, swd3, wdr5-a, wdr5-b, xwdr5
Gene Name: WD repeat domain 5
Description: WD40 repeat-containing protein
Plate: GDExl11045 Well: F06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ830758
3' ORF Sequence: JZ830759
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis WD repeat domain 5, mRNA (cDNA clone MGC:81485 IMAGE:6636637), complete cds
Template Accession: BC081008
GI: 51703445
Clone ID: IMAGE:6636637
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCAACAGAAGAAAAGAAACC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGCAGTCGCTTTTCCACAA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers