Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17304825

Xenopus ORFeome
What is the ORFeome?

ORF Name:wls.S ORF1 Species: laevis
Gene Symbol: wls.S Entrez Gene ID: 447540
Gene Synonyms: evi, gpr177, mrp, wntless
Gene Name: wntless Wnt ligand secretion mediator
Description:
Plate: GDExl11054 Well: F05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ831956
3' ORF Sequence: JZ831957
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC83940 protein, mRNA (cDNA clone MGC:83940 IMAGE:6861880), complete cds
Template Accession: BC081130
GI: 51703915
Clone ID: IMAGE:6861880
Tissue: oocyte
Stage:
Clone Library: NICHD_XGC_OO1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGGGGCTATCATT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCCTGGGCCTCCTTGC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers