Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17304831

Xenopus ORFeome
What is the ORFeome?

ORF Name:wls.L ORF1 Species: laevis
Gene Symbol: wls.L Entrez Gene ID: 735023
Gene Synonyms: evi, gpr177, mrp, wntless
Gene Name: wntless Wnt ligand secretion mediator
Description:
Plate: GDExl11080 Well: F03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ836686
3' ORF Sequence: No sequence available
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC132243, mRNA (cDNA clone MGC:85101 IMAGE:6867725), complete cds
Template Accession: BC089301
GI: 58403338
Clone ID: IMAGE:6867725
Tissue: egg
Stage: unfertilized egg stage
Clone Library: Wellcome CRC pSK egg
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGGGGCTATCATT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCCTGGGCCTCCTTGC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers