Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17304861

Xenopus ORFeome
What is the ORFeome?

ORF Name:wnt8a.L ORF1 Species: laevis
Gene Symbol: wnt8a.L Entrez Gene ID: 397970
Gene Synonyms: wnt-8, wnt8, xwnt-8, xwnt8
Gene Name: Wnt family member 8A
Description: secreted growth factor/developmental regulator
Plate: GDExl11037 Well: D09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ827234
3' ORF Sequence: JZ827235
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: low
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Wnt-1/int-1-related, mRNA (cDNA clone MGC:80495 IMAGE:5156763), complete cds
Template Accession: BC082627
GI: 52138973
Clone ID: IMAGE:5156763
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGACAGGACCCAAGGCATA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATCTCCGGTGGCCTCTGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.4


Major funding for Xenbase is provided by grant P41 HD064556