Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17304933

Xenopus ORFeome

ORF Name:xbp1 ORF2 Species: laevis
Gene Symbol: xbp1.L Entrez Gene ID: 380215
Gene Synonyms: mgc130816, mgc53678, mgc76163, xxbp1
Gene Name: X-box binding protein 1
Description: basic-leucine zipper (bZIP) transcription factor
Plate: GDExl11066 Well: H03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ834292
3' ORF Sequence: JZ834293
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis X-box binding protein 1, mRNA (cDNA clone MGC:130816 IMAGE:7975357), complete cds
Template Accession: BC110723
GI: 83405088
Clone ID: MGC:130816 IMAGE:7975357
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb9
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGTCGTGGGAGC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTCATTAATGGCGTCCAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556