Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17304945

Xenopus ORFeome

ORF Name:xgalectin-IIa ORF1 Species: laevis
Gene Symbol: lgals4.1.L Entrez Gene ID: 398290
Gene Synonyms:
Gene Name: lectin, galactoside-binding, soluble, 4, gene 1
Description: Galectin, galactose-binding lectin
Plate: GDExl11051 Well: D03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ831604
3' ORF Sequence: JZ831605
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis galectin family xgalectin-IIa, mRNA (cDNA clone MGC:82079 IMAGE:7011583), complete cds
Template Accession: BC075170
GI: 49671265
Clone ID: MGC:82079 IMAGE:7011583
Tissue: mesonephric kidney
Stage: frog
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTTATGTAGCAGCAC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAACTGTATCAGAGATATAACCAC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556