Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17305119

Xenopus ORFeome

ORF Name:yaf2 ORF1 Species: laevis
Gene Symbol: yaf2.S Entrez Gene ID: 100381052
Gene Synonyms: yaf2-a, yaf2-b
Gene Name: YY1 associated factor 2
Description: RING1 interactor RYBP and related Zn-finger-containing proteins
Plate: GDExl11065 Well: G09
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ834172
3' ORF Sequence: JZ834173
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis cDNA clone MGC:130732 IMAGE:7766332, complete cds
Template Accession: BC106268
GI: 76779466
Clone ID: Xenopus laevis cDNA clone MGC:130732 IMAGE:7766332, complete cds
Tissue: testis
Stage: frog
Clone Library: NICHD_XGC_Te2N
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGGAGACAAGAAAAGCCCGA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATGGGATTCTCCATTTATGGATGA


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556