Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17305125

Xenopus ORFeome

ORF Name:yap1 ORF1 Species: laevis
Gene Symbol: yap1.S Entrez Gene ID: 100381098
Gene Synonyms: xyap, yap, yap2, yap65, yki
Gene Name: Yes associated protein 1
Description: Ubiquitin protein ligase RSP5/NEDD4
Plate: GDExl11087 Well: C04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ838006
3' ORF Sequence: JZ838005
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis cDNA clone MGC:131098 IMAGE:7982315, complete cds
Template Accession: BC108591
GI: 80476481
Clone ID: Xenopus laevis cDNA clone MGC:131098 IMAGE:7982315, complete cds
Tissue: whole organism
Stage: NF stage 17 to NF stage 19
Clone Library: NICHD_XGC_Emb10
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAGCCCGGCTCCCAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATAACCACGTGAGAAAGCTTTCC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556