Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17305143

Xenopus ORFeome

ORF Name:ybx1 ORF1 Species: laevis
Gene Symbol: ybx1.S Entrez Gene ID: 379054
Gene Synonyms: bp-8, csda2, csdb, dbpb, frg y, frg y1, frog y-box proteins, mdr-nf1, nsep-1, nsep1, yb-1, yb1
Gene Name: Y-box binding protein 1
Description: transcription factor
Plate: GDExl11007 Well: G07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ823558
3' ORF Sequence: JZ828856
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis Nuclease-sensitive element-binding protein 1, mRNA (cDNA clone MGC:52597 IMAGE:4681490), complete cds
Template Accession: BC041191
GI: 27370847
Clone ID: MGC:52597 IMAGE:4681490
Tissue: whole organism
Stage: NF stage 31 to NF stage 32
Clone Library: NICHD_XGC_Emb4
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCAGCGAGGTTGAA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACTCAGCCCCGCCCTGCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556