Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17305311

Xenopus ORFeome
What is the ORFeome?

ORF Name:ywhag.L ORF1 Species: laevis
Gene Symbol: ywhag.L Entrez Gene ID: 379724
Gene Synonyms: 14-3-3 gamma, 14-3-3g, 14-3-3gamma, ywhag-a, ywhag-b
Gene Name: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma
Description: signal transduction
Plate: GDExl11021 Well: D05
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824720
3' ORF Sequence: JZ830072
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: high
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, gamma polypeptide, mRNA (cDNA clone MGC:69099 IMAGE:5047341), complete cds
Template Accession: BC059340
GI: 37589393
Clone ID: IMAGE:5047341
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGACCGCGAGCAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTGTTGCCTTCCCCACC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556