Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17305317

Xenopus ORFeome
What is the ORFeome?

ORF Name:ywhag.S ORF1 Species: laevis
Gene Symbol: ywhag.S Entrez Gene ID: 432005
Gene Synonyms: 14-3-3 gamma, 14-3-3g, 14-3-3gamma, ywhag-a, ywhag-b
Gene Name: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein gamma
Description: signal transduction
Plate: GDExl11023 Well: F04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ824979
3' ORF Sequence: JZ830344
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC80017, mRNA (cDNA clone MGC:80017 IMAGE:3400469), complete cds
Template Accession: BC070566
GI: 47122895
Clone ID: IMAGE:3400469
Tissue: whole organism
Stage: NF stage 24 to NF stage 25
Clone Library: NICHD_XGC_Emb3
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGACCGCGAGCAG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATTGTTGCCTTCCCCACC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.1


Major funding for Xenbase is provided by grant P41 HD064556