Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17305323

Xenopus ORFeome
What is the ORFeome?

ORF Name:ywhah.L ORF1 Species: laevis
Gene Symbol: ywhah.L Entrez Gene ID: 444832
Gene Synonyms: 14-3-3 eta, 14-3-3e
Gene Name: tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein eta
Description: signal transduction
Plate: GDExl11060 Well: G03
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ833043
3' ORF Sequence: JZ833044
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC84451 protein, mRNA (cDNA clone MGC:84451 IMAGE:7019931), complete cds
Template Accession: BC075238
GI: 49522182
Clone ID: IMAGE:7019931
Tissue: eye
Stage:
Clone Library: NICHD_XGC_Eye1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCTGATCGGGAGCA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGTTGTTCCCTTCTCCAGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.3


Major funding for Xenbase is provided by grant P41 HD064556