Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17305371

Xenopus ORFeome

ORF Name:zbtb12 ORF1 Species: laevis
Gene Symbol: zbtb12.L Entrez Gene ID: 432168
Gene Synonyms: bat9, d6s59e, ng35
Gene Name: zinc finger and BTB domain containing 12
Description: zinc finger, C2H2 type
Plate: GDExl11036 Well: B07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: No sequence available
3' ORF Sequence: JZ827026
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC79103, mRNA (cDNA clone MGC:79103 IMAGE:5048737), complete cds
Template Accession: BC072114
GI: 47939928
Clone ID: MGC:79103 IMAGE:5048737
Tissue: ovary
Stage: frog
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGCATCCTTCCCTGACATATT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAAGTCACCAACACTTTTATGTCAG


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.6.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556