Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17305407

Xenopus ORFeome

ORF Name:zbtb45 ORF1 Species: laevis
Gene Symbol: zbtb45.S Entrez Gene ID: 431816
Gene Synonyms: znf499
Gene Name: zinc finger and BTB domain containing 45
Description: zinc finger, C2H2 type
Plate: GDExl11027 Well: H10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
GE Healthcare / Dharmacon RNAi and Gene Expression,
Harvard Medical School DF/HCC DNA Resource Core


Sequences:
5' ORF Sequence: JZ825510
3' ORF Sequence: JZ825509
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: mixed
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis hypothetical protein MGC81338, mRNA (cDNA clone MGC:81338 IMAGE:6633207), complete cds
Template Accession: BC070610
GI: 47125149
Clone ID: MGC:81338 IMAGE:6633207
Tissue: whole organism
Stage: NF stage 10
Clone Library: NICHD_XGC_Emb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGTGGATGCCGTTCATT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGGCTGTATGCGTAGCAATATGT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics. [Dev Biol 2015]
Most recent:
View All Papers



My Xenbase: [ Log-in / Register ]
version: [4.5.0]

Major funding for Xenbase is provided by the National Institute of Child Health and Human Development, grant P41 HD064556