Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17305623

Xenopus ORFeome
What is the ORFeome?

ORF Name:zfand2a.L ORF1 Species: laevis
Gene Symbol: zfand2a.L Entrez Gene ID: 446668
Gene Synonyms:
Gene Name: zinc finger, AN1-type domain 2A
Description: Predicted Zn-finger protein
Plate: GDExl11044 Well: D06
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ830526
3' ORF Sequence: JZ830527
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis MGC83152 protein, mRNA (cDNA clone MGC:83152 IMAGE:6319193), complete cds
Template Accession: BC077523
GI: 50415426
Clone ID: IMAGE:6319193
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGGAATTTCCAGATCTAGGGCGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAATTTCCCTGTGGCTTTAACAGCTT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus Model Organism Knowledgebase.
Version: 4.14.0
Major funding for Xenbase is provided by grant P41 HD064556