Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17305665

Xenopus ORFeome
What is the ORFeome?

ORF Name:zfp36.L ORF1 Species: laevis
Gene Symbol: zfp36.L Entrez Gene ID: 398102
Gene Synonyms: c3h-1, g0s24, gos24, nup475, rnf162a, tis11, tristetraproline, ttp
Gene Name: ZFP36 ring finger protein
Description: zinc finger, CCCH type
Plate: GDExl11049 Well: B10
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ831572
3' ORF Sequence: JZ831573
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: good
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis CCCH zinc finger protein C3H-1, mRNA (cDNA clone MGC:83426 IMAGE:7009009), complete cds
Template Accession: BC082435
GI: 51950037
Clone ID: IMAGE:7009009
Tissue: mesonephric kidney
Stage:
Clone Library: NICHD_XGC_Kid1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTCCTCTATCCTGGATATTC
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAATCCGACACGGACAACCT


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers