Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-17305965

Xenopus ORFeome
What is the ORFeome?

ORF Name:znf585b.S ORF1 Species: laevis
Gene Symbol: znf585b.S Entrez Gene ID: 100337584
Gene Synonyms: xfdl 156, xfdl156, znf585b-a, znf585b-b
Gene Name: zinc finger protein 585B
Description: Zn-finger
Plate: GDExl11044 Well: D12
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
Source Bioscience,
EXRC,
Dharmacon,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
5' ORF Sequence: JZ830538
3' ORF Sequence: JZ830539
Predicted ORF Sequence:
Predicted ORF Translation:

Full-Length Confidence: low
Original XGC clone Full-Length: yes
Original XGC clone QC Flag: no



Template Information
Description: Xenopus laevis cDNA clone MGC:79947 IMAGE:6317147, complete cds
Template Accession: BC082825
GI: 52354600
Clone ID: IMAGE:6317147
Tissue: ovary
Stage:
Clone Library: NICHD_XGC_Ov1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGCATCTTATCAGGAACTGG
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAACCCATTTATCTCCAATTTGTAGC


Publications
First: The Xenopus ORFeome: A resource that enables functional genomics., Dev Biol 2015            
Most recent:
View All Papers



Xenbase: The Xenopus laevis and X. tropicalis resource.
Version: 4.11.2


Major funding for Xenbase is provided by grant P41 HD064556