Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19757209

Xenopus ORFeome
What is the ORFeome?

ORF Name:acat2 ORF1 Species: tropicalis
Gene Symbol: acat2 Entrez Gene ID: 394562
Gene Synonyms:
Gene Name: acetyl-CoA acetyltransferase 2
Description: Acetyl-CoA acetyltransferase
Plate: GDExt11010 Well: E07
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG133508.1
ORF Translation: ATO94860.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis acetyl-Coenzyme A acetyltransferase 2, mRNA (cDNA clone MGC:76038 IMAGE:5385015), complete cds
Template Accession: BC061429
GI: 38174442
Clone ID: IMAGE:5385015
Tissue: whole organism
Stage: NF stage 10 to NF stage 13
Clone Library: NICHD_XGC_Emb5
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGAGCTCAAGAGAGGAAAGAGT
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAACTGGTTCGTTCAATGCACATGG


Publications
First:
Most recent:
View All Papers