Click here to close Hello! We notice that you are using Internet Explorer, which is not supported by Xenbase and may cause the site to display incorrectly. We suggest using a current version of Chrome, FireFox, or Safari.
Summary Attributions Wiki Source
XB-ORF-19757324

Xenopus ORFeome
What is the ORFeome?

ORF Name:acta2 ORF1 Species: tropicalis
Gene Symbol: acta2 Entrez Gene ID: 496696
Gene Synonyms: a-sma, aat6, actsa, alpha smooth muscle actin, alpha-actin, alpha-sm-actin, asma, mymy5, sm actin, sm-actin, sma, smactin
Gene Name: actin, alpha 2, smooth muscle, aorta
Description: cytoskeletal constituent
Plate: GDExt11025 Well: A04
Order ORF:
Biodesign Institute / DNASU Plasmid Repository,
EXRC,
Harvard Medical School DF/HCC DNA Resource Core

Sequences:
ORF Sequence: MG134773.1
ORF Translation: ATO96125.1

Full-Length Confidence: good



Template Information
Description: Xenopus tropicalis actin, alpha 2, smooth muscle, aorta, mRNA (cDNA clone MGC:107783 IMAGE:7017828), complete cds
Template Accession: BC087829
GI: 56611163
Clone ID: IMAGE:7017828
Tissue: whole organism
Stage: frog
Clone Library: NICHD_XGC_Swb1
Forward Primer: GGGGACAACTTTGTACAAAAAAGTTGGCACCATGTGCGACGAGGAAGACACTA
Reverse Primer: GGGGACAACTTTGTACAAGAAAGTTGGCAAGAAGCATTTGCGGTGAACAATGGA


Publications
First:
Most recent:
View All Papers